An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

Abstract

A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d(CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [ 32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays were comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.