File Download
There are no files associated with this item.
Links for fulltext
(May Require Subscription)
- Scopus: eid_2-s2.0-0023091810
- PMID: 3558701
- WOS: WOS:A1987G307800006
- Find via

Supplementary
- Citations:
- Appears in Collections:
Article: An oligonucleotide probe for the detection of hepatitis B virus DNA in serum
| Title | An oligonucleotide probe for the detection of hepatitis B virus DNA in serum |
|---|---|
| Authors | |
| Keywords | 3'-End labelling DNA probe Molecular hybridization Oligonucleotide probe Radioautography Serum hepatitis B virus DNA |
| Issue Date | 1987 |
| Publisher | Elsevier BV. The Journal's web site is located at http://www.elsevier.com/locate/jviromet |
| Citation | Journal Of Virological Methods, 1987, v. 15 n. 2, p. 139-149 How to Cite? |
| Abstract | A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d(CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [ 32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays were comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure. |
| Persistent Identifier | http://hdl.handle.net/10722/161716 |
| ISSN | 2023 Impact Factor: 2.2 2023 SCImago Journal Rankings: 0.510 |
| ISI Accession Number ID |
| DC Field | Value | Language |
|---|---|---|
| dc.contributor.author | Lin, HJ | en_US |
| dc.contributor.author | Wu, PC | en_US |
| dc.contributor.author | Lai, CL | en_US |
| dc.date.accessioned | 2012-09-05T05:14:18Z | - |
| dc.date.available | 2012-09-05T05:14:18Z | - |
| dc.date.issued | 1987 | en_US |
| dc.identifier.citation | Journal Of Virological Methods, 1987, v. 15 n. 2, p. 139-149 | en_US |
| dc.identifier.issn | 0166-0934 | en_US |
| dc.identifier.uri | http://hdl.handle.net/10722/161716 | - |
| dc.description.abstract | A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d(CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [ 32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays were comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure. | en_US |
| dc.language | eng | en_US |
| dc.publisher | Elsevier BV. The Journal's web site is located at http://www.elsevier.com/locate/jviromet | en_US |
| dc.relation.ispartof | Journal of Virological Methods | en_US |
| dc.subject | 3'-End labelling | - |
| dc.subject | DNA probe | - |
| dc.subject | Molecular hybridization | - |
| dc.subject | Oligonucleotide probe | - |
| dc.subject | Radioautography | - |
| dc.subject | Serum hepatitis B virus DNA | - |
| dc.subject.mesh | Animals | en_US |
| dc.subject.mesh | Autoradiography | en_US |
| dc.subject.mesh | Dna, Viral - Blood | en_US |
| dc.subject.mesh | Genes, Viral | en_US |
| dc.subject.mesh | Hepatitis B Virus - Genetics - Isolation & Purification | en_US |
| dc.subject.mesh | Humans | en_US |
| dc.subject.mesh | Nucleic Acid Hybridization | en_US |
| dc.subject.mesh | Oligodeoxyribonucleotides - Diagnostic Use | en_US |
| dc.subject.mesh | Salmon | en_US |
| dc.subject.mesh | Species Specificity | en_US |
| dc.title | An oligonucleotide probe for the detection of hepatitis B virus DNA in serum | en_US |
| dc.type | Article | en_US |
| dc.identifier.email | Lai, CL:hrmelcl@hku.hk | en_US |
| dc.identifier.authority | Lai, CL=rp00314 | en_US |
| dc.description.nature | link_to_subscribed_fulltext | en_US |
| dc.identifier.pmid | 3558701 | - |
| dc.identifier.scopus | eid_2-s2.0-0023091810 | en_US |
| dc.identifier.volume | 15 | en_US |
| dc.identifier.issue | 2 | en_US |
| dc.identifier.spage | 139 | en_US |
| dc.identifier.epage | 149 | en_US |
| dc.identifier.isi | WOS:A1987G307800006 | - |
| dc.publisher.place | Netherlands | en_US |
| dc.identifier.scopusauthorid | Lin, HJ=7405571292 | en_US |
| dc.identifier.scopusauthorid | Wu, PC=7403119323 | en_US |
| dc.identifier.scopusauthorid | Lai, CL=7403086396 | en_US |
| dc.identifier.issnl | 0166-0934 | - |
